Let's say you can modify your genome, what specifically do you change? If you can't provide nucleotide sequences for your proposed changes RIGHT NOW, don't even bother posting
Let's say you can modify your genome, what specifically do you change...
yeah no one is gonna post in this thread you know
I want to add photosynthetic genes from plants into my skin so I become autotrophic
ATGGTGCACCTGACTCCTGTGGAGAAGTCYGCNGTTACTGCNYTNTGGGGCAAGGTGAACGTGGATGAAG
TTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGG
GGATCTGTCCACTCCTGATGCAGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGT
GCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACT
GTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCA
TCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCAGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAAT
GCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCC
CTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAA
CATTTATTTTCATTGC
Change to
ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCGGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAG
TTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGG
GGATCTGTCCACTCCTGATGCAGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGT
GCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACT
GTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCA
TCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAAT
GCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCC
CTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAA
CATTTATTTTCATTGC
Ok, and how are you going to do that? You didn't provide a specific sequence that you are going to change, GET OUT!
whatever sequence those plants have bro. Replace the sequence for production of melanin to produce a green pigment and make all skin cells carry chloroplasts
Something what help me survive in this cruel world. Don't have an idea. Intellect seems not linked with wealth in my country. Height and glamour too.
I'd make my body produce DMT and THC and CBD
XD
Just link your favorite bioinformatics database.
And that sequence is what? So how do you make your skin cells carry chloroplasts? Plant cells can't make chloroplasts btw, chloroplasts divide with plant cells and have their own genome.
How?
Id make my dick so big Id need 3 legged pants
How?
i see what you did there
Force chloroplasts to live in human skin cells
That's not a genomic change
engineer the chloroplasts to be born in human cells
And how do you do that?
you would still need to eat, you would not get nearly enough energy to support the biological processes that go on in a human from photosynthesis. Photosynthetic organisms have dramatically lower energy requirements
modify it so I can regrow my gottam foreskin
fuck you, obama
make my dick so small it can fit ANYWHERE undetected
but it's still stuck to you're body dumbo
In the book, "Old Man's War" the human fighting force does this to get a bit more energy from sun-like stars and such during battles. They can go without rations a good bit longer, but that's about it.
I would just delete all of my chromosomes. I've had enough.
That's not a sequence GET OUT.
Good job, at least you posted an actual sequence
I'm not a big fan of Cytosine, desu. I'd get rid of that one.
can someone blast this
Yeah right. You probably wouldn't make me a cat girl any way.
not if I sit still
>Y
I am fucking tired.
How about we remove the mitochondria
Adding chloroplasts to skin cells would be neat. We would all get a sexy green taint and free sugars.
Oh nice, you can now stand in one place all day and barely be able to breath without running out of your daily calorie input.
I'd have to have my genome sequenced and searched for any problematic alleles or mutations before I can answer this question.
To OP I would suggest inserting this gene: uniprot.org
Y actually stands for pyrimidin. So it might be a cytosin or a thymin. There is also at least one N in there, which stands for any base.
boekhoff.info
seems to be the beta subunit of hemoglobin in humans
Well...
he wants to have sickle-cell disease for some reason. or maybe he wants to heal himself from sickle-cell disease?
anyways, i'm actually kind of proud i got it
There are actually relatively few things you can do now, unless you have some genetic diseases or are screened for the few well characterized oncogenes. Personally I would just extend my telomeres by 50% for the heck of it. I'm willing to take the risks.
It's how you use intellect m8. You could be a genius but if you don't actually put your intelligence to use, your just another nobody lost in the recesses of time.
BLASTn for first seq gives 100% identity with sickle subunit. Second seq gives 100% identity with normal subunit and >99% identity for sickle subunit.
AKA he wants to get himself the healthy subunit.
You still have to eat, but way less than normal. Where is the downside?
Exactly, that's the point of this exercise. Even if we can perfectly edit DNA
fuck it; the FASTA file is too big. I want this point mutation:
hDEC2-P385R
ncbi.nlm.nih.gov
only six hours of sleep needed baby!
there's a sea snail that can do that, by integrating the cloroplasts from algae she eats
en.wikipedia.org
>Where is the downside?
you're a green freak
obviously i'd splice in the sequences for luciferase into random parts of my skin's basal membrane.
Better would be to introduce it into an embryo at the 64 cell stage
>there's a sea snail that can do that, by integrating the cloroplasts from algae she eats
that's amazing there.
>copying and pasting nucleotide sequences instead of providing the ID for some SNP or gene annotation
there's no sunlight in the basement user
wish i understood genetics :(
you would die
What problems would we run into if we tried to splice?
even if we can perfectly edit DNA we can't do much.
Uhh yes you could. Even changing a single base pair could have huge effects, given it was in an exon area.
cancer.
>The time when the Pilot episode of Batman Beyond is happened is 2 years from now.
>Batman Beyond happens in the year 2039
>Ghost in the Shell happen in the 2030s
Did we overshoot technological development when making these?
Don't worry. Even geneticists don't understand genetics. It's a terrible field in infancy.
snpedia.com
CCR5-delta32
Slight height boost and resistance to certain virus sounds nice without being too risky.
I would break my MSTN gene and edit in a rare variant of the LPR5.
Im tired and forgot to say what that does. Breaking the MSTN promotes muscle tissue to divide long past its normal cell limit. This gives the holder much denser and stronger muscles, the variant of the LPR5 i have in mind causes you to horde calcium in the bones to the point they become functionally unbreakable... swimming does become harder though.
I have marfan's so I'd fix that in order to live past fifty.
Wouldn't it just be easier to modify some intracellular bacteria?
So a cure for cancer would eventually lead to furries.
Is that from the specific family with super strong bones?
IIRC they also all look weird because of it.
Can we all just come together and revive theta defensin? It was sniped from our proteome millions of years ago by a nonsense mutation. =
I'd replace all As with Gs, all Gs with Ts, all Ts with Cs and all Cs with As
Wonder what would happen
what would happen if you just picked strings of DNA at random to change
You'd die pretty quickly. Might make a few novel proteins before your completely fail in every system
Probably nothing
Alternatively, cancer
i wud get me sum of dat uracil bitch
damn i was hoping I'd turn inside out or something
You can get from nothing, to cancer, spontaneous creutzfeldt-jakob, diabetes, Hypercholesterolemia, sickle-cell disease, Lupus...
If you manage to hit your protease regulation you might even eat yourself in agony for a few minutes.
Usefull genetic modification requires either choosing alterations that are already know to be beneficial, or a singularity type AI capable of predicting the changes.
SAO happens in 2025 I think. By 2025 we won't even have that level of VR.
Tech is developing too slow these days
SAO the game in the anime is literally a JRPG MMO with VR.
That's literally all it is with a bullshit microwave VR headset to autokill you when you die.
We can make this happen, kind of expensive and pointless though since MMOs are dying out (except in Korea/China) we could even add in sensors so you could feel stuff in the game.
What the fuck are you talking about?
neural interfaces between brains and computers won't be perfected by 2025 will they?
Plants have mitochondria too, you know.
then youd still die it would just be unimaginably and horrifyingly painful
how about we fix the mitochondria
get rid of cfs/me
eyes, ears, etc are the brain's connection to reality
There is no need to interface with thoughts or memory if you are simulating a world.
Is there a college degree for working with genes? I don't want to waste my time with other bullshit, just want to very specifically be a gene guy.
Probably not. Unless graphene turns out to be a really good interface material, or a similar material is discovered with those properties.
Problem is that touch is a powerful sense that will often break the immersion, especially if you have a bulky helmet on your head. You mainly need a 'neural interface' for movement to be believable. If you could paralyze someone similar to sleep paralysis then use an interface to detect movement 'requests', then you could easily trick the brain into believing the world it is seeing.
well guess what guys? A new neural interface has been developed that seems to be relatively stable in mice. IE unlike most other neural interfaces it doesn't kill brain cells.
It's not graphene, but glassy carbon:
nature.com
You'd have to go outside...
It would be equivalent to just removing your whole DNA. There would be no useful infromation anymore. Your cells might survive for a very short time, but they couldn't produce new proteins anymore
You never know desu
Maybe a lot of sequences accidentally create proteins that can keep the cells alive
I might also roll a dice one million times and always get a six. It's not going to happen though.
It could!